Polytechnic University of Puerto Rico

The Rapidly-exploring Random Tree (RRT) algorithm, based on incremental sampling, efficiently computes motion plans. Although the RRT algorithm quickly produces candidate feasible solutions, it tends to converge to a solution that is far from optimal. Practical applications favor "anytime" algorithms that quickly identify an initial feasible plan, then, given more computation time available during plan execution, improve the plan toward an optimal solution. This paper describes an anytime algorithm based on the RRT* which (like the RRT) finds an initial feasible solution quickly, but (unlike the RRT) almost surely converges to an optimal solution. We present two key extensions to the RRT% committed trajectories and branch-and-bound tree adaptation, that together enable the algorithm to make more efficient use of computation time online, resulting in an anytime algorithm for real-time implementation. We evaluate the method using a series of Monte Carlo runs in a high-fidelity simulation environment, and compare the operation of the RRT and RRT* methods. We also demonstrate experimental results for an outdoor wheeled robotic vehicle.

This article reviews machine learning methods for bioinformatics. It presents modelling methods, such as supervised classification, clustering and probabilistic graphical models for knowledge discovery, as well as deterministic and stochastic heuristics for optimization. Applications in genomics, proteomics, systems biology, evolution and text mining are also shown.

Smart cities have been recently pointed out by M2M experts as an emerging market with enormous potential, which is expected to drive the digital economy forward in the coming years. However, most of the current city and urban developments are based on vertical ICT solutions leading to an unsustainable sea of systems and market islands. In this work we discuss how the recent vision of the Future Internet (FI), and its particular components, Internet of Things (IoT) and Internet of Services (IoS), can become building blocks to progress towards a unified urban-scale ICT platform transforming a Smart City into an open innovation platform. Moreover, we present some results of generic implementations based on the ITU-T’s Ubiquitous Sensor Network (USN) model. The referenced platform model fulfills basic principles of open, federated and trusted platforms (FOTs) at two different levels: the infrastructure level (IoT to support the complexity of heterogeneous sensors deployed in urban spaces), and at the service level (IoS as a suit of open and standardized enablers to facilitate the composition of interoperable smart city services). We also discuss the need of infrastructures at the European level for a realistic large-scale experimentally-driven research, and present main principles of the unique-in-the-world experimental test facility under development within the SmartSantander EU project.

Purpose: The AMO framework has been widely accepted in HRM literature for explaining the linkage between human resources practices and performance. However, it remains unclear whether this model has been fully demonstrated or not. Hence, we propose a systematic review that aims at identifying those investigations that have thoroughly tested the model, as well as the approaches used by them.Design/methodology/approach: Systematic literature review, filtering scientific papers published in journals indexed in Scopus, Web of Science or Google Scholar, from the year 1993 to 2016, in the field of Social Sciences and Humanities with research that indirectly apply the AMO model in their analysis.Findings: AMO model is an excellent and structured framework that provides a better understanding of the relationship between HRM and performance. Moreover, the effectiveness of the model's proposal appears to be beyond doubt. In fact, a well trained and skilled employee will perform better, and a motivated worker will be ready to "go the extra mile". Likewise, if the work environment does not provide adequate opportunities, both abilities and motivation might become meaningless. However, we consider that many other factors could influence the positive effects of HPWS. As a matter of fact, not only contextual factors, but also individual beliefs, personal affinities, or personal circumstances (among others) might affect the implementation of these practices and the subsequent outcomes. For this reason, we consider that developing an HRM model that perfectly fit any situation is a very complicated, if not impossible, task.Research limitations/implications: The results show a significant variability in both research approaches and variables taken into consideration. In addition, it seems that little research has been conducted to verify the AMO model directly. Therefore, we consider that there is a great need to study the model from a more systematic perspective. A thorough understanding of the model could lead to a better understanding of the problems that organizations face when implementing human resource practices.Originality/value: Our study shed light on some aspects of the AMO framework within the HRM context. Specifically, we aimed to identify whether or not it is possible to confirm the model as it was originally proposed. We also find out which HR practices and measures of performance were considered across investigations, to define a standard approach.

This article presents a generic project risk management process that has been particularized for construction projects from the point of view of the owner and the consultant who may be assisting the owner. The process could also be adapted to the needs of other project participants, and many points referred to in the article can be directly applied to them. Any project risk management process must be tailored to the particular circumstances of the project and of the organization undertaking it. First, the article explains a complete or generic project risk management process to be undertaken by organizations with the highest level of risk management maturity in the largest and most complex construction projects. After that, factors influencing possible simplifications of the generic process are identified, and simplifications are proposed for some cases. Then the application to a real project is summarized. As a final validation, a Delphi analysis has been developed to assess the project risk management methodology explained here, and the results are presented.

Aerial images of the high summits of the Spanish Central Range reveal significant changes in vegetation over the period 1957 to 1991. These changes include the replacement of high-mountain grassland communities dominated by Festuca aragonensis, typical of the Cryoro-Mediterranean belt, by shrub patches of Juniperus communis ssp. alpina and Cytisus oromediterraneus from lower altitudes (Oro-Mediterranean belt). Climatic data indicate a shift towards warmer conditions in this mountainous region since the 1940s, with the shift being particularly marked from 1960. Changes include significantly higher minimum and maximum temperatures, fewer days with snow cover and a redistribution of monthly rainfall. Total yearly precipitation showed no significant variation. There were no marked changes in land use during the time frame considered, although there were minor changes in grazing species in the 19th century. It is hypothesized that the advance of woody species into higher altitudes is probably related to climate change, which could have acted in conjunction with discrete variations in landscape management. The pronounced changes observed in the plant communities of the area reflect the susceptibility of high-mountain Mediterranean species to environmental change.

Establishing flowering plants in and around fields to provide pollen and nectar resources for natural enemies has shown promise as a strategy to enhance biological control of crop pests. Natural enemies are selective in their flower feeding, however, and show preferences for certain plant species. In this study the relative attractiveness of 11 flowering plant species to aphidophagous hoverflies (Diptera: Syrphidae) was evaluated at the Oregon State University Vegetable Research Farm. Six of these plant species were also evaluated at two other farm sites. Of the 12 species of hoverflies collected, Meliscaeva cinctella (Zetterstedt), Toxomerus marginatus (Say), Toxomerus occidentalis (Curran), Sphaerophoria sulfuripes (Thomson), and Scaeva pyrastri (L.) were common to all three sites. Attractiveness of flowering plants to foraging hoverflies was assessed by conducting timed observations of feeding-visit frequencies. Flowering periods varied between plant species and comparisons were made only for plant species flowering on a particular date. Relative attractiveness of plant species to hoverflies differed between dates and sites. Among early-season flowering species, coriander, Coriandrum sativum (L.), was fed from most frequently. Among late-season flowers, yarrow, Achillea millefolium (L.), fennel, Foeniculum vulgare (Miller), and Korean licorice mint, Agastache rugosa (Fischer & C. A. Meyer) were fed from most frequently. These results help in the selection of plants to enhance biological control, but final selection of plants for this purpose requires considering flower, natural enemy, and pest phenologies, and pollen and nectar quality and availability.

Abstract Improving salt tolerance in crop plants remains an urgent issue in plant molecular biology. The adaptation of plants to NaCl involves metabolic reactions (synthesis of organic solutes) and transport phenomena (ion extrusion at the plasma membrane and vacuolar compartmentation). In addition, a plethora of salt-induced genes with a bewildering variety of suggested functions have been described. The uncertainties about the physiological roles and/or molecular bases of many of these phenomena make it difficult to select genes that could improve salt tolerance (halotolerance) in transgenic plants. We suggest that the field of salt tolerance can benefit by complementing the present phenomenological or descriptive approaches with a functional strategy directed toward isolating genes that, by overexpression of the corresponding protein, could improve salt tolerance. These halotolerance genes not only could illuminate the critical steps for salt tolerance, but also could provide the tools for improvement. Microbial genetics facilitates the implementation of this genetic approach. Studies using the prokaryotic organism Escherichia coli suggest that the synthesis of organic solutes may be the crucial step for salt tolerance because the first described bacterial halotolerance gene (proB-74) determines the overaccumulation of proline. In the eukaryotic microorganism Saccharomyces cerevisiae, however, potassium homeostasis seems to be the most critical response to salt stress. The first halotolerance gene isolated from this organism (HAL1) seems to modulate potassium transport, increasing the intracellular level of this cation in NaCl-containing media. The existence of plant homologues to HAL1 indicates that yeast may be a useful model for the genetics of salt tolerance in plants.

Screening of a genomic library from tomato plants (Lycopersicon esculentum) with a cDNA probe encoding a subtilisin-like protease (PR-P69) that is induced at the transcriptional level following pathogen attack (Tornero, P., Conejero, V., and Vera, P. (1996) Proc. Natl. Acad. Sci. U. S. A.93, 6332–6337) resulted in the isolation of a cluster of genomic clones that comprise a tandem of four different subtilisin-like protease genes (P69A, P69B, P69C, and P69D). Sequence analyses and comparison of the encoded proteins revealed that all are closely related (79 to 88% identity), suggesting that all are derived from a common ancestral gene. mRNA expression analysis as well as studies of transgenic plants transformed with promoter-β-glucuronidase fusions for each of these genes revealed that the four genes exhibit differential transcriptional regulation and expression patterns. P69A andP69D are expressed constitutively, but with different expression profiles during development, whereas the P69Band P69C genes show expression following infection withPseudomonas syringae and are also up-regulated by salicylic acid. We propose that these four P69-like proteases, as members of a complex gene family of plant subtilisin-like proteases, may be involved in a number of specific proteolytic events that occur in the plant during development and/or pathogenesis. Screening of a genomic library from tomato plants (Lycopersicon esculentum) with a cDNA probe encoding a subtilisin-like protease (PR-P69) that is induced at the transcriptional level following pathogen attack (Tornero, P., Conejero, V., and Vera, P. (1996) Proc. Natl. Acad. Sci. U. S. A.93, 6332–6337) resulted in the isolation of a cluster of genomic clones that comprise a tandem of four different subtilisin-like protease genes (P69A, P69B, P69C, and P69D). Sequence analyses and comparison of the encoded proteins revealed that all are closely related (79 to 88% identity), suggesting that all are derived from a common ancestral gene. mRNA expression analysis as well as studies of transgenic plants transformed with promoter-β-glucuronidase fusions for each of these genes revealed that the four genes exhibit differential transcriptional regulation and expression patterns. P69A andP69D are expressed constitutively, but with different expression profiles during development, whereas the P69Band P69C genes show expression following infection withPseudomonas syringae and are also up-regulated by salicylic acid. We propose that these four P69-like proteases, as members of a complex gene family of plant subtilisin-like proteases, may be involved in a number of specific proteolytic events that occur in the plant during development and/or pathogenesis. polymerase chain reaction reverse transcription Pseudomonas syringae pv. tomato salicylic acid β-glucuronidase amino acid hypersensitive response amino acids. Proteolysis is fundamental for the normal functioning of multicellular organisms and plays key roles in a variety of processes such as development, physiology, defense and stress responses, and adaptation to the changing environment. In plants, despite the importance of all these processes and involvement of different classes of proteinases (Refs. 1Glazer A.N. Smith E.L. Boyer P.D. 3rd Ed. The Enzymes. 3. Academic Press, New York1971: 501-546Google Scholar, 2Ryan C.A. The Biochemistry of Plants. 6. Academic Press, New York1981: 321-350Google Scholar, 3Schaller A. Ryan C.A. Plant Mol. Biol. 1996; 31: 1073-1077Crossref PubMed Scopus (81) Google Scholar, 4Pautot V. Holzer F.M. Reisch B. Walling L.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9906-9910Crossref PubMed Scopus (118) Google Scholar, 5Kinoshita T. Fukuzawa H. Shimada T. Saito T. Matsuda Y. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4693-4697Crossref PubMed Scopus (84) Google Scholar, and references therein), it still remains to be defined more precisely what components and molecular mechanisms are responsible for regulating specific aspects of protein degradation/processing. A major task for research will be to determine which pathway of proteolysis is responsible for the degradation of particular proteins. The serine proteases are one of the best characterized groups of proteolytic enzymes in higher organisms. They can be grouped in six clans, of which one of the largest is the subtilisin-like clan (EC3.4.21.14) that includes over 200 different members. Despite this wealth of knowledge, very little is know about subtilisin-like proteases in plants. Recently, we and others have shown the existence of members of this clan in plants, including Arabidopsis(6Ribeiro A. Akkermans A.D.L. van Kammen A. Bisseling T. Pawlowski K. Plant Cell. 1995; 7: 789-794Google Scholar), tomato (7Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (163) Google Scholar, 8Tornero P. Conejero V. Vera P. J. Biol. Chem. 1997; 272: 14412-14419Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar), melon (9Yamagata H. Masuzawa T. Nagaoka Y. Ohnishi T. Iwasaki T. J. Biol. Chem. 1994; 269: 32725-32731Abstract Full Text PDF PubMed Google Scholar), and Lilium plants (10Taylor A.A. Horsch A. Rzepczyk A. Hasenkampf C.A. Daniel Riggs C. Plant J. 1997; 12: 1261-1271Crossref PubMed Scopus (71) Google Scholar). According to a recent classification (11Siezen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (783) Google Scholar), the subtilisin-like proteases from plants can be grouped within the Pyrolysinsubfamily, which is highly related to the Kexin subfamily of proteases involved in the posttranslational processing of peptide hormones (12Barr P.J. Cell. 1991; 66: 1-3Abstract Full Text PDF PubMed Scopus (554) Google Scholar, 13Steiner D.F. Smeekens S.P. Ohagi S. Chan S.J. J. Biol. Chem. 1992; 267: 23435-23438Abstract Full Text PDF PubMed Google Scholar). Comparative molecular, biochemical, and cellular studies indicate that the subgroup of plant subtilisin-like enzymes are characterized by the presence of a large polypeptide sequence insertion preceding the reactive Ser residue and/or long C-terminal extensions relative to all other subtilisin-like proteases. Furthermore, they were found to be glycosylated and to be secreted to the plant extracellular matrix (ECM) where they accumulated and presumably exert their biochemical function(s) by recognizing and processing pericellular substrates (7Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (163) Google Scholar, 8Tornero P. Conejero V. Vera P. J. Biol. Chem. 1997; 272: 14412-14419Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 9Yamagata H. Masuzawa T. Nagaoka Y. Ohnishi T. Iwasaki T. J. Biol. Chem. 1994; 269: 32725-32731Abstract Full Text PDF PubMed Google Scholar, 10Taylor A.A. Horsch A. Rzepczyk A. Hasenkampf C.A. Daniel Riggs C. Plant J. 1997; 12: 1261-1271Crossref PubMed Scopus (71) Google Scholar, 11Siezen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (783) Google Scholar). We here describe the isolation and characterization of a genomic cluster comprised of four genes encoding different, but highly related, members of subtilisin-like proteases (named as P69A,P69B, P69C, and P69D). While the four clustered proteases exhibit a high degree of amino acid sequence identity, we show that they are differentially regulated at the transcriptional level, each showing a different expression pattern, either during normal plant development or following pathogenic attack. Lycopersicon esculentum cv. Rutgers andArabidopsis thaliana (Col-0) plants were grown at 22 °C in growth chambers programmed for a 14-h light and 10-h dark cycle. Fully expanded leaves or rosette leaves were sprayed with SA (0.5 mm) or buffer alone (50 mm phosphate buffer, pH 7.2), and samples were taken for analysis after 48 h. Suspensions of Pseudomonas syringae strains (0.09 O.D.) were infiltrated locally in one part of the leaf. Control (mock) plants were injected similarly with the solution containing no bacteria. Samples were analyzed 24–48 h post-inoculation. A tomato genomic DNA library constructed in λ-EMBL3 was screened at 65 °C as described (14Tornero P. Conejero V. Vera P. Plant J. 1996; 9: 639-648Crossref PubMed Scopus (45) Google Scholar) with the radiolabeled p26 cDNA encoding the prepro sequence of the PR-P69 protein described previously (7Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (163) Google Scholar). The positive clones were isolated and characterized with the routine described previously (14Tornero P. Conejero V. Vera P. Plant J. 1996; 9: 639-648Crossref PubMed Scopus (45) Google Scholar). cDNA synthesis, quantification of the products, and reverse transcriptase-mediated PCR1 were conducted as described (8Tornero P. Conejero V. Vera P. J. Biol. Chem. 1997; 272: 14412-14419Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). The oligonucleotide primer pairs (50 pmol each), a1 + a2 (ATGGGATTCTT GAAAATCCTT + TCAACAAAAGTGCAATTGGACTTC), b1 + b2 (ATGGGATT CTTGAAAATCCTT + CCTAGGCAGACACAACTGCAAT), c1 + c2 (ATGGGAT TCTTGAAAATCCTT + TCATATCAATGTCCTCTCAAAGAG) and d1 + d2 (ATGGGATTCTTGAAAATT + TTATTCAGCAGACACTCTAACTGC), specific for the amplification of P69A, P69B, P69C, andP69D sequences, respectively, were used to amplify by PCR the in vitro synthesized single-stranded cDNA from the different mRNA sources in a Perkin-Elmer/Cetus DNA Cycler. PCR amplification was programmed as described before (8Tornero P. Conejero V. Vera P. J. Biol. Chem. 1997; 272: 14412-14419Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). The amplified DNA fragments were visualized in agarose gels, or alternatively, they were hybridized with a radiolabeled p26 cDNA probe. The inability of each combination of primers to amplify the closely related P69 sequences was confirmed in control PCR reactions that included 10 ng of plasmid DNA containing each of the four P69 ORFs as template. Oligonucleotides GEN69a (5′-GCCCGGGGGCTTGCAAATGGTATAG-3′), GEN69b (5′-GCCCGGGGGCTAGCTAATACAACAAGTG-3′), GEN69c (5′-GCCCGGGGGCTGCAAATACAAGAAG-3′), and GEN69d (5′-GCC CCGGGTTGCTGGTATAGAGTAATTGG-3′) in combination with the T7 oligonucleotide served as primers for the incorporation of a synthetic SmaI restriction site in each promoter by site-directed mutagenesis (15Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-381Crossref PubMed Scopus (4558) Google Scholar). These primers introduced theSmaI site at positions −1 relative to the translation initiation sites in each gene. SmaI-BamHI fragments encompassing each of the P69 promoter regions were cloned upstream of the β-glucuronidase gene in pBI101.1 (16Jefferson R.A. Plant Mol. Biol. Rep. 1987; 5: 387-405Crossref Scopus (4032) Google Scholar) to generate plasmids pP69A::GUS,pP69B::GUS, pP69C::GUS, andpP69D::GUS. The resulting transcriptional fusions were verified by nucleotide sequence analysis using specific primers. The constructs were introduced into Arabidopsis plants byAgrobacterium tumefaciens mediated transformation. Transformants were selected on MS agar medium containing kanamycin, transferred to soil, and allowed to self. The transgenic lines were assayed for GUS activity by a fluorimetric assay or by an in situ assay using the colorigenic substrate X-gluc (16Jefferson R.A. Plant Mol. Biol. Rep. 1987; 5: 387-405Crossref Scopus (4032) Google Scholar). A DNA fragment encoding the signal sequence and propeptide for the previously identified P69 protease was obtained from plasmid p26 (7Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (163) Google Scholar) and used as a radiolabeled probe to screen a tomato genomic library constructed in λ-EMBL3, and different clones were isolated. After a third round of screening and purification, three λ clones (λ-5, λ-2, and λ-3′) were finally selected for restriction analysis and sequencing. These analyses revealed that the genomic DNA inserts of the three λ clones were overlapping clones encompassing ∼41 kb of genomic DNA. Alignment of the genomic sequences revealed the presence of a tandem of four transcription units that were highly similar (Fig.1). The first one, from here on designated as P69A, was identical to the previously identified P69 cDNA contained in plasmid p26. The last one in the row, and designated as P69B, was identical to the previously reported cDNA clone p9 (8Tornero P. Conejero V. Vera P. J. Biol. Chem. 1997; 272: 14412-14419Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). Between the P69A andP69B transcription units, two additional ones, designatedP69C and P69D, were identified. The four genes were intronless. While the nucleotide sequence homology for the four open reading frames was quite high (in the range of 75 to 85% identical), the comparison of the 5′ promoter regions (preceding the ATG initiation codon) or the 3′ region after the polyadenylation signal of each gene revealed no homology between them. However, in all cases, putative TATA boxes and CAAT boxes shortly upstream of the ATG initiation codon were observed (data not shown). As deduced from the nucleotide sequences of the open reading frames, the P69A,B, C, and D genes encode polypeptides of 745 aa (78,990 Da; pI 6.17), 745 aa (78,990 Da; pI 6.71), 666 aa (70,680 Da; pI 5.26), and aa Da; pI acid sequence for the P69 gene The sequence of P69A is shown in and with open reading frames for P69B, P69C, and sequence The and Ser are shown in an The propeptide were introduced to acid of each protease are the of the and homology of the four regions and are shown by positions of amino acid from the The amino the in the site and the residue are between the different P69 comparison of the amino acid sequence at the with the profiles (data not identified within the cluster the existence of a in all for the four P69 proteases. The a signal peptide at the to PubMed Scopus Google Scholar), is C-terminal of the In all cases, the signal peptide is by a acid which is a of proteases of the and is for the of the protease from the A. J. Biol. Chem. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar). The putative amino acid of the proteins is the identified also by comparison with other plant subtilisin-like proteases A. Akkermans A.D.L. van Kammen A. Bisseling T. Pawlowski K. Plant Cell. 1995; 7: 789-794Google Scholar, P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (163) Google Scholar, 8Tornero P. Conejero V. Vera P. J. Biol. Chem. 1997; 272: 14412-14419Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 9Yamagata H. Masuzawa T. Nagaoka Y. Ohnishi T. Iwasaki T. J. Biol. Chem. 1994; 269: 32725-32731Abstract Full Text PDF PubMed Google Scholar, 10Taylor A.A. Horsch A. Rzepczyk A. Hasenkampf C.A. Daniel Riggs C. Plant J. 1997; 12: 1261-1271Crossref PubMed Scopus (71) Google Scholar, 11Siezen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (783) Google Scholar). The enzymes and amino for the P69A, P69B, P69C, and the four the amino acid and for and to the site for the activity of subtilisin-like members to as proteases, were identified the proteases of the four in the cluster have an residue or for and that found to be highly in this and that is in the (12Barr P.J. Cell. 1991; 66: 1-3Abstract Full Text PDF PubMed Scopus (554) Google D.F. Smeekens S.P. Ohagi S. Chan S.J. J. Biol. Chem. 1992; 267: 23435-23438Abstract Full Text PDF PubMed Google Scholar). However, sequences to this are highly within the four In all is also an insertion of a long sequence amino between the and the reactive relative to all other subtilisin-like proteases (11Siezen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (783) Google Scholar), in which these two are by also observed in the three other subtilisin-like proteinases identified from plants A. Akkermans A.D.L. van Kammen A. Bisseling T. Pawlowski K. Plant Cell. 1995; 7: 789-794Google Scholar, 9Yamagata H. Masuzawa T. Nagaoka Y. Ohnishi T. Iwasaki T. J. Biol. Chem. 1994; 269: 32725-32731Abstract Full Text PDF PubMed Google Scholar, 10Taylor A.A. Horsch A. Rzepczyk A. Hasenkampf C.A. Daniel Riggs C. Plant J. 1997; 12: 1261-1271Crossref PubMed Scopus (71) Google Scholar) and a of the enzymes from plants The differential expression of the four P69 genes was by reactions with In vitro synthesized single-stranded from mRNA samples of grown leaves from and Pseudomonas tomato plants were assayed by PCR using of primers which were specific for each P69 gene was in using each of the cloned gene as in the PCR reaction to in expanded leaves of tomato plants, the in in the P69A were found to be induced over in leaves that were with P. similar analysis with primers specific for the gene and the P69C gene that the were in leaves from control plants, a of the in P. leaves in the of expression of the four P69 each of the 5′ promoter regions was to the β-glucuronidase gene in plasmid pBI101.1 to generate constructs pP69C::GUS, and These constructs were introduced into Arabidopsis plants by and a of were for each GUS activity was analyzed in plants grown normal growth and also after with the syringae by a fluorimetric assay (16Jefferson R.A. Plant Mol. Biol. Rep. 1987; 5: 387-405Crossref Scopus (4032) Google Scholar) (data not shown). These revealed expression of GUS activity in the transgenic plants with and whereas the or expressed GUS activity infection These to with the studies shown the of GUS activity the transgenic plants for each were and the was situ using the substrate of GUS activity by the P69A promoter was in the as well as in grown plants. As deduced from the pattern, it as the P69A gene is expressed in a in all of the in and in where no GUS activity be in transgenic plants in which GUS expression was by promoter revealed that this is in and leaves expression was it the leaves or and the gene is also observed to be expressed in and more in We still not know or not this expression in is also no expression of the GUS gene by or P69C be in of the transgenic plants However, in of the transgenic we GUS activity in groups of that and with an either in or leaves shown). expression was also analyzed in rosette leaves from transgenic plants before and after with P. syringae the which is by the gene in A. thaliana and a hypersensitive response at the These studies revealed that GUS expression by either the and was induced in the the leaves and was not to the site of where the in transgenic plants GUS expression was not induced during the of salicylic acid to be a of the plant defense to P. Y. Cell. 1992; Full Text PDF PubMed Scopus Google Scholar), we or not SA as of of these of plants with a mm solution of SA resulted in the of GUS activity in plants and and in a similar to that observed following These that the and P69C gene is involved in pathogenic response of the plant to whereas and is more related to development or to a biochemical In this we and on a genomic cluster four different members of a family of plant which on the of amino acid sequence and are related to the subtilisin-like protease clan (11Siezen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (783) Google Scholar). The genomic cluster was identified by screening of a genomic DNA library from tomato plants with a cDNA probe for the previously identified PR-P69 protease (7Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (163) Google Scholar) as The of the four P69 proteases designated P69A, P69B, P69C, and P69D, indicate that all of are synthesized as proteins of three a acid signal a acid and a polypeptide of for each protease in the the the amino acid sequences and are the of all these proteases, which are identical to of the sites of (11Siezen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (783) Google Scholar). also is the of an insertion of a long sequence amino between the residue and the reactive Ser of the relative to all other subtilisin-like proteases. The of such a remains but it may in regulating the of this subgroup of in plants. Comparative studies of the of expression by and by analysis of transgenic plants fusions for the four P69 genes indicate that they are regulated is at all of plant growth and in all and where the expression is is also in but expression is expression pattern, which observed also in transgenic plants (data not is presumably with the processes in these transcription is the leaves is not expressed in transcription is in and in the in P69A gene expression is induced over during pathogenesis. or P69C show expression in of plants grown are infection with either in transgenic Arabidopsis plants or in tomato plants. is with that one of this identified as on the of sequence identity, is induced with a of proteins with the defense response in tomato plants (7Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (163) Google Scholar, P. Conejero V. Plant PubMed Google Scholar, P. Conejero V. Mol. Plant Scopus Google Scholar). the that the induced transcriptional of and P69C is not to the of with the where the and the of genes occur R.A. Plant Plant Mol. Biol. Scopus Google Scholar), but is the that their is mediated by a long the SA is one of the signal long of plant defense reactions P. Y. Cell. 1992; Full Text PDF PubMed Scopus Google Scholar), we the of SA to expression of these two The in that of SA to leaves the transcription of genes these with the that proteases, and in particular members of the subtilisin-like are components of the plant response to The differential expression found for these four indicate that different mechanisms have to control the expression of these genes either during normal growth or remains to be or not these differential expression also different roles for the protein In this it is to that the expression of the P69A gene at the different of growth of the plant may a for the P69A protein and that this may be during processes of plant and/or by with the other that may to the in where substrates for subtilisin-like proteases have identified (12Barr P.J. Cell. 1991; 66: 1-3Abstract Full Text PDF PubMed Scopus (554) Google Scholar, 13Steiner D.F. Smeekens S.P. Ohagi S. Chan S.J. J. Biol. Chem. 1992; 267: 23435-23438Abstract Full Text PDF PubMed Google Scholar), that the different protease members of a family are from their and assayed in of these proteases are to the the of such a the family members in and this be into by the expression of the protease members J. 1994; PubMed Scopus Google Scholar). such it shown that protease substrate in is by expression to particular and also by of the enzymes to specific J. A. Mol. 1992; 6: PubMed Scopus Google Scholar). it may be the that a similar regulation also for the differentially regulated P69 protease as a for in we the that each by recognizing different and that and gene expression but for each P69 the of such the of either the regulation of gene expression or for each of the P69 clan be in with the found for other gene in higher plants, which from gene events of a common ancestral gene R.A. PubMed Scopus Google Scholar, S. A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: PubMed Scopus Google Scholar). two protein substrates have identified for these plant subtilisin-like proteases. is the peptide processes during response in plants A. Ryan C.A. Proc. Natl. Acad. Sci. U. S. A. 1994; PubMed Scopus Google Scholar), the other is P. Conejero V. Vera P. Plant J. 1996; PubMed Scopus (81) Google Scholar), an extracellular matrix protein that is part of a family of proteins that molecular and/or protein processes B. J. Sci. 1994; Full Text PDF PubMed Scopus Google Scholar). enzymes have shown to be secreted to the plant extracellular matrix (ECM) P. J. Conejero V. Plant PubMed Google Scholar). the that the may be in pericellular events may indicate a similar to in of Press, New Google Scholar, Biol. 1992; PubMed Scopus Google Scholar), in the of the plant with the extracellular environment. We and for the

El propósito de este articulo radica en analizar e interpretar la pluralidad de las perspectivas que nos muestran los puntos de vista coincidentes y contrapuestos entre el investigador y los sujetos, siendo paradójicamente uno de los aspectos que enriquece y nutre de complejidad y diversidad de técnicas e instrumentos de recolección de información en el análisis y procesamiento de la investigación cualitativa. Entre las técnicas de recolección de información consideradas se destacan la observación participante, el grupo nominal, Delphi, entrevista a profundidad, grupos focales, revisión documental, taller investigativo y técnicas proyectivas, y en cuanto los instrumentos se recalcan la guía de observación, anecdotarios, diario del investigador y artefactos. En relación al análisis y procesamiento de la información indagada se enfatizan la inducción analítica, método comparativo constante, codificación, descripción densa, análisis de contenido y análisis del discurso, perspectiva de mapeo y la triangulación. Todas y cada una de ellas permiten revelar como piensan, sienten y actúan los sujetos involucrados en una investigación, razón principal por la que es primordial aplicar cada técnica e instrumento adecuadamente, proporcionando una enorme riqueza informativa que pueden corregir los sesgos propios de cada método.

Overexpression of the HAL1 gene in yeast has a positive effect on salt tolerance by maintaining a high internal K(+) concentration and decreasing intracellular Na(+) during salt stress. In the present work, the yeast gene HAL1 was introduced into tomato (Lycopersicon esculentum Mill.) by Agrobacterium tumefaciens-mediated transformation. A sample of primary transformants was self-pollinated, and progeny from both transformed and non-transformed plants (controls) were evaluated for salt tolerance in vitro and in vivo. Results from different tests indicated a higher level of salt tolerance in the progeny of two different transgenic plants bearing four copies or one copy of the HAL1 gene. In addition, measurement of the intracellular K(+) to Na(+) ratios showed that transgenic lines were able to retain more K(+) than the control under salt stress. Although plants and yeast cannot be compared in an absolute sense, these results indicate that the mechanism controlling the positive effect of the HAL1 gene on salt tolerance may be similar in transgenic plants and yeast.

A paradigm for Hall discharge modeling is presented whereby only the time scale of the lowest-frequency mode is explicitly resolved. The ability of such a low-frequency model to reproduce with excellent accuracy the breathing mode is demonstrated through comparisons with a fully time-dependent numerical model. Based on this formalism, an approximate linearized model is derived which essentially constitutes a one-dimensional generalization of the classical zero-dimensional predator-prey model. The model highlights the interaction of standing plasma waves with the transport of neutral species, which involves standing and convective waves of similar magnitude. It predicts a frequency which is in close agreement with the frequency of the small perturbation modes observed in simulations. Finally, it is shown that unstable modes are in general strongly nonlinear and characterized by frequencies obeying a scaling law different from that of linear modes.

Abstract The growth conditions to achieve group‐III‐nitride nanocolumns and nanocolumnar heterostructures by plasma‐assisted molecular beam epitaxy are studied. The evolution of the nanocolumnar morphology with the growth conditions is determined for (Ga,Al)N and (In,Ga)N nanocolumns. The mechanisms behind the nanocolumnar growth under high N‐rich conditions are clarified in the sense that no seeding or catalysts are required, as it is the case in the vapour‐liquid‐solid model that applies to most nanocolumns grown by metal organic chemical vapour deposition, either with group‐III nitrides, II–VI or III–V compounds. Some examples of nanocolumnar heterostructures are given, like quantum disks and cylindrical nanocavities. Preliminary results on the growth of arrays of ordered GaN nanocolumns are reported. (© 2007 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim)

By using biochemical, immunological, and molecular strategies we have identified and cloned a cDNA encoding a protease from tomato (Lycopersicon esculentum) plants (P69B) that is part of a proteolytic system activated in the plant as a result of infection with citrus exocortis viroid. This new protease is closely related, in terms of amino acid sequence and structural organization, to the previously identified pathogenesis-related subtilisin-like protease (Tornero, P., Conejero, V., and Vera, P. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6332–6337). The 745-residue amino acid sequence of P69B begins with a cleavable signal peptide, contains a prodomain and a 631-residue mature domain which is homologous to the catalytic modules of bacterial subtilisins and eukaryotic Kex2-like proteases. Within the catalytic domain, the essential Asp, His, and Ser residues that conform the catalytic triad of this family of proteases are conserved in P69B. Northern blot and reverse transcriptase-polymerase chain reaction analysis demonstrated widespread induced expression of the 2.5-kilobase hybridizing mRNA in plant tissues as a consequence of viroid infection. We propose that P69B is a member of a complex gene family of plant Kex2/subtilisin-like proteases presumably involved in a number of specific proteolytic events activated during pathogenesis in plants and that takes place in the extracellular matrix. By using biochemical, immunological, and molecular strategies we have identified and cloned a cDNA encoding a protease from tomato (Lycopersicon esculentum) plants (P69B) that is part of a proteolytic system activated in the plant as a result of infection with citrus exocortis viroid. This new protease is closely related, in terms of amino acid sequence and structural organization, to the previously identified pathogenesis-related subtilisin-like protease (Tornero, P., Conejero, V., and Vera, P. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6332–6337). The 745-residue amino acid sequence of P69B begins with a cleavable signal peptide, contains a prodomain and a 631-residue mature domain which is homologous to the catalytic modules of bacterial subtilisins and eukaryotic Kex2-like proteases. Within the catalytic domain, the essential Asp, His, and Ser residues that conform the catalytic triad of this family of proteases are conserved in P69B. Northern blot and reverse transcriptase-polymerase chain reaction analysis demonstrated widespread induced expression of the 2.5-kilobase hybridizing mRNA in plant tissues as a consequence of viroid infection. We propose that P69B is a member of a complex gene family of plant Kex2/subtilisin-like proteases presumably involved in a number of specific proteolytic events activated during pathogenesis in plants and that takes place in the extracellular matrix. Infection of plants with pathogens results in the induction of numerous host-specific biochemical responses, some of which are critical for the ability of the plant to withstand diseases (1Dixon R.A. Lamb C.J. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1990; 41: 339-367Crossref Scopus (557) Google Scholar). Physiological and pathological studies have examined diseased plants in the hope of uncovering the cause(s) of the pathogen-induced distress, and there is a plethora of studies describing the dramatic effect of pathogen infection upon different aspects of plant metabolism and catabolic disturbances (2Fraser R.S.S. Biochemistry of Virus-infected Plants. John Wiley & Sons, Chichester, United Kingdom1989Google Scholar, 3Zaitlin M. Hull R. Annu. Rev. Plant Physiol. 1987; 38: 291-315Crossref Google Scholar, 4Goodman R.N Novacky A.J. The Hypersensitive Reaction in Plants to Pathogens. APS Press, St. Paul, MN1994Google Scholar). What is lacking, however, is a clear understanding of how different pathogens promote the often deleterious symptoms observed by switching on a common cascade of cellular events resulting in the disease syndrome and the accompanying resistant character to subsequent pathogenic attacks. Viroids are the smallest known plant infectious agents, made up of nude, circular, single-stranded RNA molecules of a few hundred nucleotides which do not code for any protein (5Diener T.O. The Viroids. Plenum, New York1987Google Scholar, 6Semancik J.S. Viroids and Viroid-like Pathogens. CRC Press, Boca Raton, FL1987Google Scholar), and thus they are an adequate model to analyze the physiological and molecular basis of plant responses to pathogen infection. This is more relevant if we consider that the viroid elicited responses resemble those resulting from infection by more complex type of pathogens or different kind of stresses (7Semancik J.S. Conejero V. Semancik J.S. Viroid and Viroid-like Pathogens. CRC Press, Boca Raton, FL1987: 72-120Google Scholar, 8Conejero V. Bellés J.M. Garcı́a-Breijo F. Garro R. Hernández-Yago J. Rodrigo I. Vera P. NATO ASI Ser. Ser. H Cell Biol. 1990; 14: 233-261Google Scholar). It has been shown previously (8Conejero V. Bellés J.M. Garcı́a-Breijo F. Garro R. Hernández-Yago J. Rodrigo I. Vera P. NATO ASI Ser. Ser. H Cell Biol. 1990; 14: 233-261Google Scholar) that plants infected with viroids produce de novo synthesis of a set of host-encoded proteins termed pathogenesis-related (PR) 1The abbreviations used arePRpathogenesis-related;RTreverse transcription;PCRpolymerase chain reaction;PAGEpolyacrylamide gel electrophoresis. proteins. The function of some PR proteins as hydrolytic enzymes (e.g. chitinases or β-1,3-glucanases) has been demonstrated in many plant species irrespective of the nature of the attacking pathogen, and they appear to play a role in the induced defense response of the plant to combat pathogens (9Bol J, F. Linthorst H.J.M. Cornelissen B.J.C. Annu. Rev. Phytopath. 1990; 28: 113-138Crossref Google Scholar, 10Bowles D.J. Annu. Rev. Biochem. 1990; 59: 873-907Crossref PubMed Scopus (866) Google Scholar). pathogenesis-related; reverse transcription; polymerase chain reaction; polyacrylamide gel electrophoresis. Protein degradation as well as protein processing and maturation are believed to be important events in the plant defense response (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar, 12Schaller A. Ryan C.A. Plant Mol. Biol. 1996; 31: 1073-1077Crossref PubMed Scopus (81) Google Scholar, 13Pautot V. Holzer F.M. Reisch B. Walling L.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9906-9910Crossref PubMed Scopus (118) Google Scholar). In this regard, one of the viroid-induced PR proteins has been identified as a protease that was termed PR-P69 (14Vera P. Conejero V. Plant Physiol. 1988; 87: 58-63Crossref PubMed Google Scholar, 15Vera P. Conejero V. Physiol. Mol. Plant Pathol. 1989; 34: 323-334Crossref Scopus (32) Google Scholar). Recent molecular cloning (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar) indicated that P69 is a protein structurally related to the yeast processing protease Kex2, the prototypic member of the eukaryotic subtilisin-like protease family. This new finding broadens our understanding of defense responses activated by microbes, and opens a new perspective to unravel how plants perceive pathogenic insults and activate signaling processes that results in a resistant character to subsequent pathogenic challenges. In this paper we have have explored the existence of additional proteolytic activities activated in tomato plants following viroid infection. We performed comparative chromatographic fractionation of cell homogenates and determined differences in proteolytic profiles between healthy and infected plants. Using specific antibodies raised against the previously identified P69 protease, we identified a distinct, but immunologically related P69-like proteinase, that accumulates also in infected tissues. These studies were followed by the cloning of an inducible gene encoding a new subtilisin-like proteinase member related to the previously identified P69 protease (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar). We also discuss possible functions for this inducible protease family during pathogenesis in plants. Conditions for growth of tomato plants (Lycopersicon esculentum), and method for inoculation with citrus exocortis viroid have been described (8Conejero V. Bellés J.M. Garcı́a-Breijo F. Garro R. Hernández-Yago J. Rodrigo I. Vera P. NATO ASI Ser. Ser. H Cell Biol. 1990; 14: 233-261Google Scholar). Tissues were harvested 4 weeks after inoculation and stored at −80 °C. Restriction enzymes and modification enzymes were obtained from Boehringer. DEAE Sepharose CL-6B, T7-sequencing, and Ready-to-go DNA labeling kits were obtained from Pharmacia. Radioactive compounds were from Amersham Corp. All other commonly available reagents were of analytical grade. All operations were carried out on ice or at 4 °C. Leaf tissue (10 g) showing symptoms of viroid infection was frozen in liquid nitrogen, thawed, and homogenized in a mortar and pestle with 30 ml of buffer A (50 mm Tris-HCl, pH 7.21, 2 mm dithiothreitol, 1 mmCaCl2, 1 mm MgCl2). The homogenate was filtered through cheesecloth and centrifuged at 15,000 ×g for 20 min. Supernatants were immediately used or stored at °C. The was to with and centrifuged at 15,000 for min. The was to with and centrifuged as described The resulting was in ml of buffer (50 mm Tris-HCl, pH and in in buffer A. The proteins were to a in buffer A. with the was with ml of a of in the were for proteolytic using as as described previously (14Vera P. Conejero V. Plant Physiol. 1988; 87: 58-63Crossref PubMed Google Scholar) and the protein by were carried out in polyacrylamide as described previously (14Vera P. Conejero V. Plant Physiol. 1988; 87: 58-63Crossref PubMed Google Scholar). were with used were and of proteins from was performed as described previously P. Conejero V. Physiol. Mol. Plant Pathol. 1989; 34: 323-334Crossref Scopus (32) Google Scholar). The were for as described previously using (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar) and the with and A cDNA was from mRNA from tomato P. P. Conejero V. Mol. 1993; Google Scholar). The was at as described by and Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar) with a cDNA encoding the protein (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar), and were by P. P. Conejero V. Mol. 1993; Google Scholar). cDNA were from cloned and by using a polymerase DNA sequence analysis was performed on by the chain method M. Biochem. 1987; Scopus Google Scholar). of the cDNA cloned in were using an and were using and of the of J. P. 1987; Scopus Google Scholar). RNA was from different tomato plant tissues as described J. J. Biochem. 1987; PubMed Scopus Google Scholar). RNA gel blot of RNA were on and & of RNA was by of the gel to the the RNA were with a cDNA for the gene to DNA was from as described A.J. R.A. Plant The Scholar). DNA gel blot of DNA was with enzymes and in a gel and RNA and DNA gel were with the cDNA or with the of cDNA which was by using polymerase and of were at as described Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). cDNA of the and reverse were as described S. J.M. Plant 1996; Google Scholar). The (50 and were used to an of the in single-stranded cDNA from the different mRNA in a DNA was for 30 with of for 1 for 2 and for min. The DNA were in or with a cDNA The of to the closely related protease sequence was in that of DNA the cDNA as were carried out in of DNA the P69B to proteolytic activities induced in tomato plants upon infection with citrus exocortis tissue homogenates were by on 1 chromatographic profiles from tissue homogenates from healthy and citrus exocortis plants after with a of differences in proteolytic activities were observed between of was used as for the of proteolytic In profiles from plants 1 the of different of proteolytic were observed with the proteolytic from healthy plants 1 with the and at by of proteins in the differences in the protein In the of plants 1 the of a set of proteins to the previously identified inducible PR proteins P. Conejero V. Physiol. Mol. Plant Pathol. 1989; 34: 323-334Crossref Scopus (32) Google Scholar) was These proteins in the of proteolytic and the protein previously identified as a of proteolytic (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar, P. Conejero V. Plant Physiol. 1988; 87: 58-63Crossref PubMed Google P. Conejero V. Physiol. Mol. Plant Pathol. 1989; 34: 323-334Crossref Scopus (32) Google Scholar). of proteins in to from infected plants not differences with healthy in an additional protein which was not in the from healthy plants. The inducible nature and in molecular of the proteins in and to for between proteins in and and the proteins from healthy were to blot analysis using an This that the antibodies the protein in and from infected was observed in the from healthy plants. the chromatographic was on the of the the of the that the previously identified P69 proteinase in homogenates from plants (14Vera P. Conejero V. Plant Physiol. 1988; 87: 58-63Crossref PubMed Google Scholar) was in a of different with biochemical and but with different chromatographic of antibodies proteins in proteolytic and from infected plants or the from healthy plants. are shown on the on the of between we cloning of the new P69 member by with antibodies and also by at with the cDNA previously described (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar) as a in cDNA from of a cDNA from tomato plants P. P. Conejero V. Mol. 1993; Google Scholar) not any result of the cDNA with a cDNA a of cDNA Restriction and sequence analysis of cDNA indicated that of the previously identified P69 the cDNA a different of cDNA was and in The sequence and the amino acid sequence from the in are shown in The cDNA contains nucleotides the and RNA gel blot using the cDNA as a a of in that the cDNA is an The with an at that is by that the sequence conserved for in M. PubMed Scopus Google Scholar), and at the at of the The is by an the that the is that at The protein has a molecular of and a of amino which is that the proteins by antibodies This was by in of the cDNA in which the synthesis of an protein not the of the sequence not and of amino acid sequence of the indicated the existence of a This of a signal at the The as by 14: PubMed Scopus Google Scholar), of this signal after This is followed by a acid which is a of proteases of the family and for the proteolytic of the is an important in the of the protease from the A. J. Biol. PubMed Scopus Google Scholar). The amino acid of the mature protein is identified by with other plant subtilisin-like proteases (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar, J. Biol. PubMed Google Scholar, A. A. Plant PubMed Scopus Google Scholar), and is indicated in the mature contains amino with a molecular of The amino acid for this mature protein is with that determined previously for the P69 proteinase and this structural the observed of other using antibodies upon the of we to this identified P69 proteinase as the previously identified one be as The amino acid sequence of P69B with that of is in of the P69B with other subtilisin-like the sequence of the P69B is with sequence differences in the The and the amino the catalytic triad in the and the conserved are by in which are to those of P69B are indicated by were to of of P69B to the amino acid sequence the catalytic residues of Kex2, and The of the amino acid of the proteins is indicated by the to of to those of P69 are indicated by residues are indicated acid residues of protease are from the Within the mature P69B protein the amino acid residues and common to subtilisin-like were The the catalytic are to the catalytic triad essential for of the subtilisin-like to function as and with A and the protein has an that has been to be conserved in this and is important in the subtilisins PubMed Scopus Google Scholar, S. J. Biol. PubMed Google Scholar). the the amino of the there is an of a sequence amino between the and the to other subtilisin-like which are by This has also been observed in the other subtilisin-like identified from plants (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar, J. Biol. PubMed Google Scholar, A. A. Plant PubMed Scopus Google Scholar). The of a but at a of the enzymes from plants. The expression of P69B was determined in different tissues from healthy and plants by Northern blot The were at with the cDNA The results that the of P69B which has a of is in and in tissue from infected the mRNA from healthy plants a with the and after of the with the The that the observed in P69B gene expression in infected tissues be by with the mRNA for the previously identified gene was also an to that the expression of the P69B gene was induced in infected plants In single-stranded from mRNA of and from healthy or plants were by in a with to a and and specific for of P69B but not for the were used in to P69B gene an of the RNA from and tissues of tomato but not the RNA of healthy the The were also by blot analysis with a cDNA not a the P69B cDNA or cDNA were and the the P69B cDNA the This that the observed using and also that P69B is induced during The of in from healthy plants that the mRNA species observed in Northern from healthy plants expression of different subtilisin-like with other the existence of other in tomato more analysis was using DNA and cDNA DNA gel blot shown in was performed to the of of the A blot tomato DNA with enzymes was with the cDNA and demonstrated the of a number of and of different that P69 conform a family of This was also but at a a DNA was with a cDNA the the catalytic domain of the enzymes used in this the this result to that the P69 gene family is of at but closely related of which of and have been identified In this we structural and on a member of a family of plant proteases induced during the response of tomato plants to pathogen P69B a new plant subtilisin-like protease on amino acid sequence and structural PubMed Scopus Google Scholar, S. J. Biol. PubMed Google Scholar) which is related amino to the previously identified PR-P69 protease (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar) as The of P69B that the protein is as a of a acid signal peptide, a acid and a acid mature that is the of the that accumulates in Within the mature the amino acid and is the of P69B and are closely related to those of the catalytic of the subtilisin-like proteases. from analysis of the different with the conserved amino acid the catalytic we have P69B as a new member of the subtilisin-like family of In this of proteases is also to These are involved in the proteolytic processing of and other at of of amino acid residues PubMed Scopus Google Scholar). the of as the subtilisin-like protease for processing in the yeast A. J. Proc. Natl. Acad. Sci. U. S. A. 1989; PubMed Scopus Google Scholar), which in the processing of protein and protein were identified and and J. M. M. M. R. Proc. Acad. Sci. U. S. A. 1996; 93: PubMed Scopus Google Scholar) for one of the that Kex2/subtilisin-like have also been and U. M. de J. Biol. Google Scholar, de J. Scopus Google Scholar, J.S. J. PubMed Google Scholar) with sequence to which sequence to Mol. 14: PubMed Scopus Google Scholar). In molecular of the gene from which was shown by analysis of to be essential for the of this has that also gene related to the Kex2/subtilisin-like protease M. PubMed Scopus Google Scholar). sequence analysis protein which have been and These proteins a common amino but at the and are from In was available to the existence of proteases A. Ryan C.A. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar) a subtilisin-like protease was from J. Biol. PubMed Google Scholar). cDNA encoding subtilisin-like proteases have been identified in other plant species the previously identified from tomato plants (11Tornero P. Conejero V. Vera P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6332-6337Crossref PubMed Scopus (164) Google Scholar). a cDNA encoding a subtilisin-like protease was shown to be during of A. A. Plant PubMed Scopus Google Scholar). a gene encoding a closely related subtilisin-like protease has been identified and expression A. A. Plant PubMed Scopus Google Scholar). that the gene family has been conserved of plants. with the of expression observed in plants for the different of this family of the tomato plant are during analysis that many more are in the of tomato and that additional to be be at of an of the of and with the of related that through gene thus that subtilisin-like enzymes biochemical some of which are important during is an that a one to the of subtilisin-like proteases. In for subtilisin-like proteases have been identified PubMed Scopus Google Scholar, S. J. Biol. PubMed Google Scholar), but has been observed that the different are from and in many of proteases are to the This the of a the family in and how this be has been by the expression and of the which to be a function of the structural differences between family member J. PubMed Scopus Google Scholar). has been shown that in be by expression to tissues and also of the enzymes to specific R. J. A. M. Mol. PubMed Scopus Google Scholar), and is a for functions which to a that in plants for the specific of the different subtilisin-like or pathogenic or other the of this family of proteases plant subtilisin-like enzymes described have in common some that from the of other eukaryotic In as with the of plant the of a sequence amino between the conserved and the Ser residues of the catalytic to other subtilisin-like proteases. The of a conserved but important functions in the of this of subtilisin-like enzymes are as a which is believed to function as an the of the protease domain and from the is in the A. J. Biol. PubMed Scopus Google Scholar). in other eukaryotic the and the catalytic are by the to from the and have an additional conserved at the A. J. Biol. PubMed Scopus Google Scholar). In the of plant the at is the is This that the plant mature and also have with to the presumably as a to cellular through the In this regard, other eukaryotic function specific of the the plant enzymes function after to the of the This also for subtilisins from studies of the P69 protease P. Hernández-Yago J. Conejero V. Plant Physiol. 1989; PubMed Google Scholar) that the in the and with the biochemical that if not of the be in an the P. Hernández-Yago J. Conejero V. Plant Physiol. 1989; PubMed Google Scholar). the of of plant be the extracellular matrix. This more if we consider that the extracellular the cell has been to be part of the of the plant cell as by P. The of Plant Scholar). The that the P69 proteolytic system described is induced during pathogenesis in plants is also in with the of This with the extracellular of the mature new for the of possible of and a role of proteases to the of the plant cell with the extracellular is a of in that between extracellular proteases and important protein during processes related to signal as tissue or in disease Cell of Press, New Google Scholar, Cell Biol. PubMed Scopus Google Scholar). In of in specific proteases and of growth and other important molecules through the on specific In this we have identified a extracellular protein that is by the P69 proteolytic system in plants P. Conejero V. Vera P. Plant J. 1996; PubMed Scopus (81) Google Scholar). to the conserved family of proteins that molecular processes in the extracellular of eukaryotic to different signaling processes B. J. Biochem. Sci. PubMed Scopus Google Scholar). the physiological from the processing of this is that of the family are in proteolytic processes in the plant cell a Kex2-like protease has been to in the and processing of the signaling processes during response in plants A. Ryan C.A. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar), and thus of of plant subtilisin-like proteases in processing of important signaling proteolytic degradation of the extracellular by the of encoding proteolytic the subtilisin-like proteases that and be as a by which plant during different processes and in pathological and which a number of different cellular processes important for the of the we the that proteases also as the attacking pathogens or by proteins by the In encoding a or an protease are also activated and during the defense response of tomato plants A. Ryan C.A. Plant Mol. Biol. 1996; 31: 1073-1077Crossref PubMed Scopus (81) Google Scholar, 13Pautot V. Holzer F.M. Reisch B. Walling L.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9906-9910Crossref PubMed Scopus (118) Google Scholar). is that expression of encoding different protease, or with different common strategies by plants to against as a defense or through the modification of proteins that in the of defense the that a extracellular protease the of P69 proteases and related proteins I. Vera P. Conejero V. J. Biochem. 1989; PubMed Scopus Google Scholar, I. Vera P. Conejero V. Plant Physiol. PubMed Scopus Google Scholar), that a of between different as proteolytic enzymes or as for the of other in plants. This new of that be in the for a understanding of how is in plants. studies on the role of pathogen-induced extracellular proteases in as well as and cloning of additional family and of and are one of our for the

The photoreactivity of the nonsteroidal anti-inflammatory 2-arylpropionic acids benoxaprofen, carprofen, naproxen, ketoprofen, tiaprofenic acid, and suprofen is reviewed with special emphasis on fundamental photophysical and photochemical properties. The absorption and emission properties of the excited states of these drugs as well as their main photodegradation routes are summarized. The photochemical mechanisms are discussed on the basis of product studies and detection of short-lived intermediates by means of laser flash photolysis. After dealing with the unimolecular processes, attention is focused on the photosensitized reactions of key biomolecules, such as lipids, proteins or nucleic acids. Finally, a short section on the photobiological effects on simple biological models is also included. Although some earlier citations are included, the literature coverage is in general limited to the last decade.

Cancer is the second largest cause of death worldwide with the number of new cancer cases predicted to grow significantly in the next decades. Biotechnology and medicine can and should work hand-in-hand to improve cancer diagnosis and treatment efficacy. However, success has been frequently limited, in particular when treating late-stage solid tumors. There still is the need to develop smart and synergistic therapeutic approaches to achieve the synthesis of strong and effective drugs and delivery systems. Much interest has been paid to the development of smart drug delivery systems (drug-loaded particles) that utilize passive targeting, active targeting, and/or stimulus responsiveness strategies. This review will summarize some main ideas about the effect of each strategy and how the combination of some or all of them has shown to be effective. After a brief introduction of current cancer therapies and their limitations, we describe the biological barriers that nanoparticles need to overcome, followed by presenting different types of drug delivery systems to improve drug accumulation in tumors. Then, we describe cancer cell membrane targets that increase cellular drug uptake through active targeting mechanisms. Stimulus-responsive targeting is also discussed by looking at the intra- and extracellular conditions for specific drug release. We include a significant amount of information summarized in tables and figures on nanoparticle-based therapeutics, PEGylated drugs, different ligands for the design of active-targeted systems, and targeting of different organs. We also discuss some still prevailing fundamental limitations of these approaches, eg, by occlusion of targeting ligands.

This paper presents the solution of the following optimization problem that appears in the design of double-loop structures for local networks and also in data memory, allocation and data alignment in SIMD processors.

Germanium inverse opals with a full photonic bandgap in the NIR region are accessible by CVD. Deposition of digermane on sintered opals made of silica microspheres, followed by removal of the silica by etching, yields inverted Ge opals (see Figure for an SEM image of a cleaved edge, revealing the Ge layer) whose lattice parameters, network topology, and Ge coating thickness determine the optical properties of the inverse Ge opal.

Intelligent systems and communication technologies have experienced huge advances in the last few years. AAL can benefit from mixing both research fields. This article presents an intelligent communication architecture for AAL. It uses artificial intelligence to process the information gathered from several types of communication (e.g., wireless sensor networks, wireless ad hoc networks, wireless mesh networks) over any type of communication technologies (e.g., device-to-device, machine-to-machine, sensor-actuator), know what is happening in the network, and detect if elderly people need assistance. The article shows the main intelligent algorithms included in the AAL system and the developed software application. Several real measurements validate the operation of our proposal.

Coffee has traditionally been a commodity product sold in a highly competitive and saturated global market. This lack of product differentiation has made coffee farmers very vulnerable to fluctuating prices. During the last decade, the coffee industry is undergoing a process of decommoditisation, offering an opportunity for farmers to differentiate their coffee in terms of sustainability and quality and to commercialise it more directly. However, smallholder farmers face productivity and transactional constraints that inhibit them from accessing these higher?value market segments. Intermediaries are needed to connect them with this new market. In this article, we present a cross?case study analysis of three ‘connective businesses’ that are facilitating direct trade relationships between smallholder farmers and speciality coffee roasters.